circad | circRNAs associated with diseases

hsa_circ_0000096
Gene	HIAT1	Organism	Human
Genome Locus	chr1:100515464-100535241:+	Build	hg19
Disease	Gastric Cancer	ICD-10	Stomach, Malignant neoplasm of unspecified (C16.9)
DBLink	Link to database	PMID	28081541
Experimental Method
Sample Type	Tissues	Comparison	101 paired gastric cancer tissues and adjacent non-tumorous tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CAGTCCTTGGCATTCTTTCC Reverse GTGGGTGCTGTCAATAGTCC	Statistics	Fold Change : Downregulated pvalue : p<0.001
Citation
Li, P, Chen, H, Chen, S, Mo, X, Li, T, Xiao, B, Yu, R, Guo, J (2017). Circular RNA 0000096 affects cell growth and migration in gastric cancer. Br. J. Cancer, 116, 5:626-633.